|
1
|
|
Sector
|
Education And Research Institute Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Himachal Pradesh Tenders
|
Ref.No
|
77838165
|
|
Closing Date
|
30 - Nov - 2024
|
19 Days to go
|
View Tender Details
|
|
Supply of Alt-R-CRISPR-Cas9 sgRNA, Alt-CRISPR-Cas9crRNA(FLA gl: CTAGGAGGTGAATCTCTCGT, Alt-RCRISPR-Cas9crRNA(FLA g2: TTAGAGGTGTCACGAAA CTA), Alt-R CRISPR-Cas9 crRNA (FLA g3: ATAACGATACAGTTGCAAGT), Alt-R CRISPR Cas9 crRNA (DVT Gl: TCTGTTGGTGAAGAAAATGC), Alt-R CRISPR- Cas9 crRNA(DVT g2: ATAATCTAACCCCTGCAGAG), Alt-R CRISPR-Cas9 crRNA(DVT g3: TATGTAGCGCCTCTCTGCAG), Alt-R CRISPR-Cas9 crRNA XT, Alt-R CRISPR-Cas9 sgRNA, Alt-R CRISPR-Cas9 Tracr RNA, Alt-R S p HiFi-Cas9 Nuclease V3, Nuclease Free Duplex Buffer, Nuclease Free Duplex Buffer (10x2ml), IDTE(1XTE Solution), IDTE(1X TE Solution; 10x2ml)
Qty:26
|
|
|
|
|
|
|
|
|
|
|
|
6
|
|
Sector
|
Security Services Tenders
|
Tender Value
|
 3.78 Lakh approx.
|
|
Location
|
Himachal Pradesh Tenders
|
Ref.No
|
77630618
|
|
Closing Date
|
19 - Nov - 2024
|
8 Days to go
|
View Tender Details
|
|
Supply of Cell Culture Rabies Vaccine Vial of 1 Ml / Rabipur Inj, Acamprosate 333 Mg Tab, X Ray Film 10 X 08 Cr( Pkt of 150 Films), Mometasone Nasal Spray 50 Mcg/dose, Bott of 10ml, Tranexamic Acid 500 Mg/5ml Inj, Etophylline Bp 84.7 Mg and Theophylline Ip 25.3, Per Ml, 2 Ml Inj, Promethazine Hcl 2.5%, 25mg/ml, 2 Ml Inj, Dopamine Hcl 40 Mg/ml, 5ml Inj, Paediatric Ambu Bag 500ml Capacity, Ventilator Masks (circular) Size-0, Ventilator Masks (circular) Size-00, I Gel Size-1, I Gel Size-1.5, I Gel Size-2, Paediatric Vein Finder ( Ir-lamp), Paediatric Spo2 Probe/ Paediatric Pulseoxymeter, Clinidipine 5 Mg Tab., Glucometer Strip Contour Plus (50 Strips), Erypeg 100 Mcg/0.3 Ml) Inj (human Erythropoietin), Erypeg 50 Mcg/0.3 Ml) Inj (human Erythropoietin), Inj Phenylephrine Inj 10 Mg, Inj Phenytoin Sodium 100mg 7ml, Drainage Bag 15 Lit Or More for Apd Fluid, Syp Levetiracetam Bott, Central Line 3fr, Tab Semaglutide 3 Mg, Liquid Developer for Automatic Processor with Starter, Streptokinase 15 Lacs Iu Inj, R/c Fluticasone + Vilanterol 25 Mcg, Tab Zinc Acetate 50mg, Aceclofenac + Tizanidine 2 Mg, Tab Bilastine 20 Mg, Rotacap Levosalbutamol Mcg + Ipratropium Bromide 20 Mcg, Phenytoin Sodium 100 Mg Tab, Vitamin D3 (200 Iu/ml) Drops, Myo-inositol, d-chiro-insitil, chromium Oicolinate and Vitamin D2 Tablet ( Normoz), Dehydroepiandrostero 75mg Tab, Pheniramine Malate Inj 22.75 Mg Per Ml Amp of 2 Ml Inj, Vecuronium Bromide 4mg/ml, 1 Ml Inj, Microgen D-125 Solution 1 Ltr, Glutaraldehyde 0.55% Ortho-pthaldehyde Cidex 5 Liter, Isoprenaline Hcl 200 Mcg/ml, 1 Ml Inj, Inj. Reteplase 18 Mg, Tab Faropenem 200 Mg, H. Pylori Kit(amoxicillin +tinidazole +omeprazole), Hme Filter for Tracheostomy Tube, Foleys Ballon Catheter Rubber 10fr, Foleys Ballon Catheter Rubber 6fr, Foleys Catheter 8f, Nasogastric Tube (ryles) 100cm Long 8f, Nasogastric Tube (ryles) 100cm Long 10f, Tube Feeding Smooth Plastic Infant 38 Cm Long, 5 F, Nebulization Mask with T-piece & Tubing for Ventilator Circuit, Face Mask for Oxygen with Nebulization Chamber, Paed, Cartridges for I Stat Analyser- Cg8+,
Qty : 8043
|
|
|
|
|
|
8
|
|
Sector
|
Education And Research Institute Tenders
|
Tender Value
|
N.A.
|
|
Location
|
Himachal Pradesh Tenders
|
Ref.No
|
77303193
|
|
Closing Date
|
18 - Nov - 2024
|
7 Days to go
|
View Tender Details
|
|
Supply of Mannitol 1kg, Calcium chloride dehydrate 500mg, Iodoacetamide 25 g, polyethyelne Glycol 500g, Cellulase Onozuka R-10 yakult 5g, Driselase 5g, Lyticase 25g, Pectinase 25g, Maleic anhydride 25g, Potassium Chloride 500g, Magnesium Sulfate 500g, Sorbitol 500g, Lytic enzyme 10g, Sucrose 500g, Macerozyme 10g, Tris Base 200g, Hydrochloride acid HCL 500ml, Guanidine HCL 100g, Triton X -100 50ml, Poilyvinyl pyrrolidone k30 100g, Tween 80 100ml, Phenol Chloroform Isoamly alcohol 500ml, Proteinase k 10mg, Malt extract 7 kg, Agar Agar type 1 7kg, Test Tube without rim 2000 nos, Labdet 05 phosphate free 5 litrs, solvent Resistant Pens 10 pices, Fine Tip Marker pcs, Dimlin, Melathon, Kavach, Formaline, Sodium Hydroxide pellets 500g, Nuclear free water 50ml each, Pipette tips, PCR strips, Taq DNA polymerase 5000unit, DNTP set 10sets, First str cDNA synthesis kit 10 sets, Ethidium bromide 10g, Diethyl procabonate 50 ml, Ferrous sulphate heptahydrate 500g, Filter paper grade, Beakers, Hyrogen peroxide 500 ml each, Syringe filter 50ea, Hexane 500ml, Acetone 500 ml, Test Tube without rim, Labdet 05 natural phosphate free, Sterile Petri plates, Activated carbon 500gm, L Ascorbic acid 100gm, benzoic acid 500gm, calcium chloride 500gm, Calcium Gluconate monohydrate 500gm, Calcium lactate pentahydrate 500gm, Calcium phosphate 500gm, Calcium proionate 500gm, trans cinnamic acid 500gm, citric acid 500gm, Iron powder reduced 500g, Glarlic acid monohydrate 500gm, Glutathione 25gm, L Cysteine Hydrochloride Monohydrate 100g, Kojic acid 100gm, L Cysteine 100gm, N acetyl L cysteine 25gm, Nisin 25gm, Potassium metabisulphite 500gm, Potassium permanganate 500gm, Sodium Bicarbonate 500gm, Sorbic acid 500gm, L-Tartaric acid 500gm, Zeolite type-Y 100gm, 4-hexylresorcinol 25gm, Potassioum dihydrogen phosphate 100gm, di-Potassium hydrogen phosphate 100gm, Malt extract 500gm, Agar Agar type 1 500gm, Tri-Sodium citrate dihydrate 500gm, Magnesium sulfate 500gm, Zinc sulphate 500gm, Ammonium iron-II sulphate 500gm, Copper sulphate 500gm, Sodium molybdate 500gm, Caffeic acid 25g, Coumaric acid 25g, Pyruvic acid 100ml, Succinic acid 500g, Conical Flask 100 ml borisilicate, Conical Flask 500 ml borisilicate, Conical flask 1000ml borosilicate, Conical flask 2000ml borosilicate, disposable hairnets, Disposable gloves food grade plastic transparant, Apron cotton, Cotton cloth sheet width 100 INCH, Ethanol absolute 5litre, Chloroauric acid 250 MG, a-Amylase 25 mg each, Protease 500mg, Amyloglucosidase 25mg
|
|
|
|
|
|
|